Stem-loop sequence eca-mir-9068

AccessionMI0028241 (change log)
DescriptionEquus caballus miR-9068 stem-loop
Stem-loop
   ucugagga      --aga       ga     - -      --ag   g   uc  gg      --   g  -g     u 
5'         ccaggg     augccug  ccaug c cgugac    auc uga  ac  gcaucu  ggc cu  cgggg g
           ||||||     |||||||  ||||| | ||||||    ||| |||  ||  ||||||  ||| ||  |||||  
3'         gguccu     ugcggac  gguac g gugcug    ugg acu  ug  cguaga  ccg gg  gucuc u
   -------g      gugug       -g     u u      gggg   g   --  ga      cg   g  ga     c 
Get sequence
Deep sequencing
4 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr3: 32455695-32455839 [-]
intergenic
Database links

Mature sequence eca-miR-9068

Accession MIMAT0034613
Sequence

41 - 

aucgugaucacgggcaucuggcgcu

 - 65

Get sequence
Deep sequencing4 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).