Stem-loop sequence eca-mir-9070

AccessionMI0028243 (change log)
DescriptionEquus caballus miR-9070 stem-loop
Stem-loop
   ---------        c  gau   ugg      --g    u   aaggau     -au   ug gccgu   g 
5'          aggggcca ug   ggc   gucaca   gugg aca      cagcc   ucu  g     ugg c
            |||||||| ||   |||   ||||||   |||| |||      |||||   |||  |     |||  
3'          uucccggu ac   uug   uagugu   cacc ugu      gucgg   aga  c     acc a
   acggaccac        c  -au   ---      gga    u   ------     agu   gu -----   a 
Get sequence
Deep sequencing
8 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr3: 119160267-119160391 [-]
antisense
ENSECAT00000025958 ; GAK-201; intron 9
ENSECAT00000025969 ; GAK-202; intron 9
Database links

Mature sequence eca-miR-9070

Accession MIMAT0034615
Sequence

71 - 

ugagaugaggcuguguuccacaggu

 - 95

Get sequence
Deep sequencing6 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).