Stem-loop sequence eca-mir-9079

AccessionMI0028252 (change log)
DescriptionEquus caballus miR-9079 stem-loop
Stem-loop
   ag   a   g  uguuuu      -------u      aaac        u   c  u   -        ---------    a 
5'   cga uau gc      cauggg        gucucu    gauaccac agg ug uga gggcugca         uggu u
     ||| ||| ||      ||||||        ||||||    |||||||| ||| || ||| ||||||||         ||||  
3'   gcu aug ug      gugccc        uagaga    cuauggug ucc ac acu cuugacgu         acca a
   --   g   g  -ugagu      cuuggucu      ----        -   a  u   g        uguaacuga    g 
Get sequence
Deep sequencing
363 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr3: 22431359-22431503 [+]
intergenic
Database links

Mature sequence eca-miR-9079

Accession MIMAT0034624
Sequence

81 - 

uguugcaguucgucaucaaccugug

 - 105

Get sequence
Deep sequencing191 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).