Stem-loop sequence eca-mir-9080

AccessionMI0028253 (change log)
DescriptionEquus caballus miR-9080 stem-loop
Gene family MIPF0001982; mir-9080
Stem-loop
   ---------ca  u     aguc       -guag  ug      -          u   a        aa   ua 
5'            ag cccuu    guauccg     uc  caucca agauucaacc acc uggaucau  aca  g
              || |||||    |||||||     ||  |||||| |||||||||| ||| ||||||||  |||   
3'            uc gggag    cauaggu     ag  guaggu ucuaaguugg ugg gccuagua  ugu  u
   cuaucugucaa  -     ---a       guaca  gu      g          u   a        ca   ca 
Get sequence
Deep sequencing
33 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr29: 10893677-10893815 [+]
intergenic
Database links

Mature sequence eca-miR-9080

Accession MIMAT0034625
Sequence

78 - 

auccgagguugguugaaucugu

 - 99

Get sequence
Deep sequencing31 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).