Stem-loop sequence eca-mir-9154

AccessionMI0028377 (change log)
DescriptionEquus caballus miR-9154 stem-loop
Stem-loop
   acucaagagugcaguugcuguaaugagcugccacuuuu                       aa 
5'                                       gcagugucagcuaugggccugag  a
                                         |||||||||||||||||||||||  u
3'                                       cgucacaguugauacucggacuc  g
   guccugcugauacgaccuucguacacuugaacccgcua                       cg 
Get sequence
Deep sequencing
4 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr15: 81985440-81985568 [-]
intergenic
Database links

Mature sequence eca-miR-9154

Accession MIMAT0034730
Sequence

36 - 

uuugcagugucagcuaugggcc

 - 57

Get sequence
Deep sequencing3 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).