Stem-loop sequence efu-mir-9246c

AccessionMI0028538 (change log)
DescriptionEptesicus fuscus miR-9246c stem-loop
Gene family MIPF0001940; mir-9246
Stem-loop
   --ag   a  gc      ---   -    agc   g  gg  u 
5'     ccc ug  uccccu   ggu ugca   cuc ug  uu u
       ||| ||  ||||||   ||| ||||   ||| ||  ||  
3'     ggg au  aggggg   ccg augu   gag au  gg a
   guaa   g  aa      uuu   c    --a   g  uu  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EptFus1.0; GCA_000308155.1) Overlapping transcripts
JH977672.1: 1449272-1449351 [+]
intergenic
Database links

Mature sequence efu-miR-9246c

Accession MIMAT0034863
Sequence

11 - 

uccccugguugcaagccucgu

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).