Stem-loop sequence efu-mir-9275

AccessionMI0028597 (change log)
DescriptionEptesicus fuscus miR-9275 stem-loop
Stem-loop
   --augg         g   g               gug 
5'       gaaggguga cgu agaacagcuggcucg   g
         ||||||||| ||| |||||||||||||||   u
3'       cuucccgcu gua ucuugucggccgagu   g
   agugua         a   g               aug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EptFus1.0; GCA_000308155.1) Overlapping transcripts
JH977658.1: 4676514-4676590 [-]
intergenic
Database links

Mature sequence efu-miR-9275

Accession MIMAT0034912
Sequence

11 - 

ugagcgugagaacagcuggcuc

 - 32

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).