Stem-loop sequence efu-mir-9280

AccessionMI0028603 (change log)
DescriptionEptesicus fuscus miR-9280 stem-loop
Stem-loop
   ccccucc    g agca           g        -ca  a 
5'        ccag c    gagggcagagu ggagaggg   gc u
          |||| |    ||||||||||| ||||||||   ||  
3'        gguc g    cucccgucuca ccucuucc   ug u
   ---ucca    a gacc           g        cag  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EptFus1.0; GCA_000308155.1) Overlapping transcripts
JH977735.1: 1519739-1519822 [-]
intergenic
Database links

Mature sequence efu-miR-9280

Accession MIMAT0034918
Sequence

53 - 

uucuccgacucugcccucccag

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).