Stem-loop sequence efu-mir-493

AccessionMI0028615 (change log)
DescriptionEptesicus fuscus miR-493 stem-loop
Gene family MIPF0000230; mir-493
Stem-loop
   --cuc        u                    cauuc  u 
5'      uagggccu guacaugguaggcuuucauu     gu u
        |||||||| ||||||||||||||||||||     ||  
3'      gucccgga cgugugucaucuggaagugg     ca g
   accgu        c                    -cuua  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EptFus1.0; GCA_000308155.1) Overlapping transcripts
JH977717.1: 1004658-1004740 [-]
intergenic
Database links

Mature sequence efu-miR-493

Accession MIMAT0034929
Sequence

11 - 

uuguacaugguaggcuuucauucau

 - 35

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).