Stem-loop sequence efu-mir-9286

AccessionMI0028625 (change log)
DescriptionEptesicus fuscus miR-9286 stem-loop
Stem-loop
   --    c                           agagucca 
5'   ugca guaguccuaagaaauuaagaugaaacu        g
     |||| |||||||||||||||||||||||||||         
3'   acgu caucaggauucuuuaauucuacuuuga        a
   gu    a                           aguaaaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EptFus1.0; GCA_000308155.1) Overlapping transcripts
JH977829.1: 90092-90175 [-]
intergenic
Database links

Mature sequence efu-miR-9286

Accession MIMAT0034940
Sequence

53 - 

uuucaucuuaauuucuuaggac

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).