Stem-loop sequence efu-mir-9290

AccessionMI0028633 (change log)
DescriptionEptesicus fuscus miR-9290 stem-loop
Stem-loop
   --c  c   ag       ca a  c   u a    g -  a 
5'    ga ugg  gaggggc  c cu ggg g ccuu g au u
      || |||  |||||||  | || ||| | |||| | || u
3'    cu acc  cucuccg  g ga ccc c ggaa c ug u
   ggu  c   cu       uc c  c   u -    g a  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EptFus1.0; GCA_000308155.1) Overlapping transcripts
JH977811.1: 1416102-1416182 [-]
intergenic
Database links

Mature sequence efu-miR-9290

Accession MIMAT0034948
Sequence

50 - 

ggcuccccagcgcugccucucu

 - 71

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).