Stem-loop sequence efu-mir-9186n

AccessionMI0028647 (change log)
DescriptionEptesicus fuscus miR-9186n stem-loop
Gene family MIPF0001868; mir-9186
Stem-loop
   --     u     uu      a g         auguaau 
5'   uaggg gaggg  gcagua g cugguacug       g
     ||||| |||||  |||||| | |||||||||        
3'   auccc cuccu  cgucgu c gaccaugac       g
   ac     c     uc      a a         cccuguc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EptFus1.0; GCA_000308155.1) Overlapping transcripts
JH977753.1: 4018-4097 [-]
intergenic
Clustered miRNAs
< 10kb from efu-mir-9186n
efu-mir-9186p-2JH977753.1: 13964-14043 [-]
efu-mir-9186p-1JH977753.1: 10736-10815 [-]
efu-mir-9186f-3JH977753.1: 8086-8165 [-]
efu-mir-9186nJH977753.1: 4018-4097 [-]
Database links

Mature sequence efu-miR-9186n

Accession MIMAT0034962
Sequence

11 - 

guugcaguaaggcugguacugau

 - 33

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).