Stem-loop sequence efu-mir-92a

AccessionMI0028680 (change log)
DescriptionEptesicus fuscus miR-92a stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   --ca   a         g     uu  u   u     -    u 
5'     uuc uccaugggu gggau  gu gca uacuu gugu u
       ||| ||||||||| |||||  || ||| ||||| ||||  
3'     aag agguguccg cccug  ca cgu augaa uaua a
   agaa   a         g     uu  -   u     a    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EptFus1.0; GCA_000308155.1) Overlapping transcripts
JH977765.1: 950947-951030 [+]
intergenic
Clustered miRNAs
< 10kb from efu-mir-92a
efu-mir-19JH977765.1: 950805-950892 [+]
efu-mir-92aJH977765.1: 950947-951030 [+]
Database links

Mature sequence efu-miR-92a

Accession MIMAT0034995
Sequence

52 - 

uauugcacuugucccggccugug

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).