Stem-loop sequence efu-mir-200a

AccessionMI0028698 (change log)
DescriptionEptesicus fuscus miR-200a stem-loop
Gene family MIPF0000019; mir-8
Stem-loop
   --gcc   g        -             c    -   uc 
5'      ccu ugggcauc uuaccggacagug ugga uua  g
        ||| |||||||| ||||||||||||| |||| |||   
3'      gga acuuguag aauggucugucac aucu agu  g
   ccagu   a        c             a    c   uc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EptFus1.0; GCA_000308155.1) Overlapping transcripts
JH977681.1: 208600-208681 [+]
intergenic
Clustered miRNAs
< 10kb from efu-mir-200a
efu-mir-200bJH977681.1: 208041-208120 [+]
efu-mir-200aJH977681.1: 208600-208681 [+]
efu-mir-429JH977681.1: 209798-209876 [+]
Database links

Mature sequence efu-miR-200a

Accession MIMAT0035013
Sequence

49 - 

uaacacugucugguaacgauguuc

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).