Stem-loop sequence efu-mir-381

AccessionMI0028786 (change log)
DescriptionEptesicus fuscus miR-381 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
   --         a  c   g        u        -gg     
5'   ugguacuua ag gag uugcccuu guauauuc   guuu 
     ||||||||| || ||| |||||||| ||||||||   ||| u
3'   acuaugagu uc cuc aacgggaa cauauaag   cagu 
   aa         g  u   g        -        aua     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EptFus1.0; GCA_000308155.1) Overlapping transcripts
JH977717.1: 850848-850930 [-]
intergenic
Clustered miRNAs
< 10kb from efu-mir-381
efu-mir-495JH977717.1: 859846-859925 [-]
efu-mir-3958JH977717.1: 858317-858394 [-]
efu-mir-376JH977717.1: 855568-855645 [-]
efu-mir-1185JH977717.1: 852489-852568 [-]
efu-mir-381JH977717.1: 850848-850930 [-]
efu-mir-487JH977717.1: 845018-845095 [-]
efu-mir-382JH977717.1: 842272-842348 [-]
efu-mir-485JH977717.1: 841215-841293 [-]
Database links

Mature sequence efu-miR-381

Accession MIMAT0035093
Sequence

51 - 

auauacaagggcaagcucucugu

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).