Stem-loop sequence efu-mir-1185

AccessionMI0028787 (change log)
DescriptionEptesicus fuscus miR-1185 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
   -     u    -     aa a     u           uua 
5'  gguac ugaa aagag  u cccuu guauguucacu   u
    ||||| |||| |||||  | ||||| |||||||||||    
3'  cuaug guuu uucuc  a gggga cauguaagugg   u
   a     c    a     ag -     -           uaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EptFus1.0; GCA_000308155.1) Overlapping transcripts
JH977717.1: 852489-852568 [-]
intergenic
Clustered miRNAs
< 10kb from efu-mir-1185
efu-mir-495JH977717.1: 859846-859925 [-]
efu-mir-3958JH977717.1: 858317-858394 [-]
efu-mir-376JH977717.1: 855568-855645 [-]
efu-mir-1185JH977717.1: 852489-852568 [-]
efu-mir-381JH977717.1: 850848-850930 [-]
efu-mir-487JH977717.1: 845018-845095 [-]
Database links

Mature sequence efu-miR-1185

Accession MIMAT0035094
Sequence

49 - 

aauguacaggggagacucuuau

 - 70

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).