Stem-loop sequence efu-mir-141

AccessionMI0028790 (change log)
DescriptionEptesicus fuscus miR-141 stem-loop
Gene family MIPF0000019; mir-8
Stem-loop
   --    u   c       --    u        -   ugg  ua 
5'   gcuc ggg ccaucuu  ccag acaguguu gga   uc  a
     |||| ||| |||||||  |||| |||||||| |||   ||  u
3'   cggg ccc gguagaa  gguc ugucacaa ccu   ag  c
   gu    c   c       au    -        u   cga  cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EptFus1.0; GCA_000308155.1) Overlapping transcripts
JH977638.1: 17350306-17350390 [+]
intergenic
Clustered miRNAs
< 10kb from efu-mir-141
efu-mir-200cJH977638.1: 17349898-17349980 [+]
efu-mir-141JH977638.1: 17350306-17350390 [+]
Database links

Mature sequence efu-miR-141

Accession MIMAT0035097
Sequence

53 - 

uaacacugucugguaaagauggc

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).