Stem-loop sequence efu-mir-92b

AccessionMI0028867 (change log)
DescriptionEptesicus fuscus miR-92b stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   -  -c    g     ga       c            uucuu 
5'  gg  gggc ggagg  cgggacg ggugcaguguug     u
    ||  |||| |||||  ||||||| ||||||||||||     c
3'  cc  cccg ccucc  gcccugc ucacguuauaac     c
   g  uc    g     -g       -            cgccc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EptFus1.0; GCA_000308155.1) Overlapping transcripts
JH977735.1: 1353204-1353286 [-]
intergenic
Database links

Mature sequence efu-miR-92b

Accession MIMAT0035160
Sequence

52 - 

uauugcacucgucccggccucc

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).