Stem-loop sequence efu-mir-25

AccessionMI0028874 (change log)
DescriptionEptesicus fuscus miR-25 stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   --   a ug   ag    g     uu g     u   --  ac 
5'   gcc g  uug  aggc gagac  g gcaau gcu  gg  g
     ||| |  |||  |||| |||||  | ||||| |||  ||  c
3'   cgg c  gac  ucug cucug  c cguua cgg  cc  u
   cc   c gu   ag    g     uu a     -   gu  cg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EptFus1.0; GCA_000308155.1) Overlapping transcripts
JH977625.1: 7044806-7044889 [-]
intergenic
Clustered miRNAs
< 10kb from efu-mir-25
efu-mir-106JH977625.1: 7045231-7045313 [-]
efu-mir-93JH977625.1: 7045012-7045095 [-]
efu-mir-25JH977625.1: 7044806-7044889 [-]
Database links

Mature sequence efu-miR-25

Accession MIMAT0035166
Sequence

51 - 

cauugcacuugucucggucugaca

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).