Stem-loop sequence efu-mir-221

AccessionMI0028911 (change log)
DescriptionEptesicus fuscus miR-221 stem-loop
Gene family MIPF0000051; mir-221
Literature search

1 open access papers mention efu-mir-221
(1 sentences)

Stem-loop
   --ucg        -  ug   u         auuu    -   u 
5'      ggcuugaa cc  gca acaauguag    cugu guu g
        |||||||| ||  ||| |||||||||    |||| ||| u
3'      ucggacuu gg  cgu uguuacauc    gaca cga u
   gucca        u  gu   c         ----    a   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EptFus1.0; GCA_000308155.1) Overlapping transcripts
JH977694.1: 1249314-1249396 [+]
intergenic
Clustered miRNAs
< 10kb from efu-mir-221
efu-mir-222JH977694.1: 1248625-1248708 [+]
efu-mir-221JH977694.1: 1249314-1249396 [+]
Database links

Mature sequence efu-miR-221

Accession MIMAT0035196
Sequence

11 - 

accuggcauacaauguagauuucug

 - 35

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).