Stem-loop sequence dme-mir-9374

AccessionMI0028923 (change log)
DescriptionDrosophila melanogaster miR-9374 stem-loop
Stem-loop
   ---c        auuu  u       -ca  a 
5'     gugcaaua    cc cgauugg   uc a
       ||||||||    || |||||||   ||  
3'     cacguuau    gg gcugacc   gg g
   agaa        acau  -       uuc  u 
Get sequence
Deep sequencing
47 reads, 0 reads per million, 27 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2L: 21238301-21238361 [+]
sense
FBtr0081479 ; Hr39-RB; 3'UTR (exon 2)
FBtr0081481 ; Hr39-RD; 3'UTR (exon 2)
FBtr0081480 ; Hr39-RA; 3'UTR (exon 2)
FBtr0081478 ; Hr39-RC; 3'UTR (exon 2)
Database links

Mature sequence dme-miR-9374-5p

Accession MIMAT0035211
Sequence

1 - 

cgugcaauaauuuccucgauugg

 - 23

Get sequence
Deep sequencing37 reads, 21 experiments
Evidence experimental; Illumina [1]

Mature sequence dme-miR-9374-3p

Accession MIMAT0035212
Sequence

39 - 

agucggguacauauugcacaag

 - 60

Get sequence
Deep sequencing7 reads, 7 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:23882112 "The impact of age, biogenesis, and genomic clustering on Drosophila microRNA evolution" Mohammed J, Flynt AS, Siepel A, Lai EC RNA. 19:1295-1308(2013).