Stem-loop sequence hbr-MIR9386

AccessionMI0028935 (change log)
DescriptionHevea brasiliensis miR9386 stem-loop
Stem-loop
   u       c  c    a           u                    caa  acuu 
5'  uagcuuu ac caau accuuugcagu cgaaaguggaagcuuuuuca   cc    u
    ||||||| || |||| ||||||||||| ||||||||||||||||||||   ||     
3'  gucgaga ug guua uggaaacguua gcuuucaccuucgagaaggu   gg    g
   c       -  a    a           -                    uaa  auag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Hevbra_1.0; GCA_000340545.1) Overlapping transcripts
AJJZ010379917.1: 682-797 [-]
intergenic
Database links

Mature sequence hbr-miR9386

Accession MIMAT0035235
Sequence

21 - 

uuugcaguucgaaaguggaagc

 - 42

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24218245 "The small RNA profile in latex from Hevea brasiliensis trees is affected by tapping panel dryness" Gebelin V, Leclercq J, Kuswanhadi, Argout X, Chaidamsari T, Hu S, Tang C, Sarah G, Yang M, Montoro P Tree Physiol. 33:1084-1098(2013).