Stem-loop sequence gsa-mir-2a

AccessionMI0028952 (change log)
DescriptionGyrodactylus salaris miR-2a stem-loop
Stem-loop
   --   - --     c           ua  u  u 
5'   guc c  gagug gacugugaugu  ug ca g
     ||| |  ||||| |||||||||||  || ||  
3'   cag g  uucgu cugacacuaua  ac gu u
   gg   u gu     c           --  -  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence gsa-miR-2a-5p

Accession MIMAT0035266
Sequence

1 - 

guccgagugcgacugugauguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence gsa-miR-2a-3p

Accession MIMAT0035267
Sequence

38 - 

uaucacaguccugcuuuggugacgg

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24025793 "Substantial loss of conserved and gain of novel MicroRNA families in flatworms" Fromm B, Worren MM, Hahn C, Hovig E, Bachmann L Mol Biol Evol. 30:2619-2628(2013).