Stem-loop sequence gsa-mir-184c

AccessionMI0028981 (change log)
DescriptionGyrodactylus salaris miR-184c stem-loop
Stem-loop
   ga          a c  ----    c     uu   a   au 
5'   ucuuuaacaa u uc    cguc aucuu  uua gaa  u
     |||||||||| | ||    |||| |||||  ||| |||  a
3'   agaaauuguu a ag    guag uagaa  aau cuu  c
   --          a a  caau    u     -c   c   aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence gsa-miR-184c-5p

Accession MIMAT0035324
Sequence

1 - 

gaucuuuaacaaaucuccgucca

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence gsa-miR-184c-3p

Accession MIMAT0035325
Sequence

58 - 

gauguaacgaaaauuguuaaaga

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24025793 "Substantial loss of conserved and gain of novel MicroRNA families in flatworms" Fromm B, Worren MM, Hahn C, Hovig E, Bachmann L Mol Biol Evol. 30:2619-2628(2013).