Stem-loop sequence gsa-mir-9397

AccessionMI0028989 (change log)
DescriptionGyrodactylus salaris miR-9397 stem-loop
Stem-loop
   ---a      uuc     a     acccaac      cu 
5'     gaugua   uuggc cgaga       aaucga  c
       ||||||   ||||| |||||       ||||||  u
3'     cuacgu   aaucg gcucu       uuagcu  c
   uucg      uaa     -     --aaacu      au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence gsa-miR-9397-5p

Accession MIMAT0035340
Sequence

1 - 

agauguauucuuggcacgaga

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence gsa-miR-9397-3p

Accession MIMAT0035341
Sequence

53 - 

ucucggcuaaaauugcaucgcuu

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24025793 "Substantial loss of conserved and gain of novel MicroRNA families in flatworms" Fromm B, Worren MM, Hahn C, Hovig E, Bachmann L Mol Biol Evol. 30:2619-2628(2013).