Stem-loop sequence gsa-mir-9404

AccessionMI0028997 (change log)
DescriptionGyrodactylus salaris miR-9404 stem-loop
Stem-loop
   gc u   a      a        aaguc 
5'   g cuc gagguc aacacagu     a
     | ||| |||||| ||||||||      
3'   c gag cuccgg uugugucg     u
   gu u   c      a        aauua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence gsa-miR-9404-5p

Accession MIMAT0035356
Sequence

1 - 

gcgucucagaggucaaacacag

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence gsa-miR-9404-3p

Accession MIMAT0035357
Sequence

38 - 

uguguuaggccuccgagucug

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24025793 "Substantial loss of conserved and gain of novel MicroRNA families in flatworms" Fromm B, Worren MM, Hahn C, Hovig E, Bachmann L Mol Biol Evol. 30:2619-2628(2013).