Stem-loop sequence nve-mir-9420

AccessionMI0029024 (change log)
DescriptionNematostella vectensis miR-9420 stem-loop
Stem-loop
     u      aaaa  -- c       --g    ga 
5' gc ugggcu    ca  c gcugauu   auau  a
   || ||||||    ||  | |||||||   ||||  a
3' ug guccga    gu  g cgacuaa   uaua  u
     u      -agg  ca c       aca    ac 
Get sequence
Deep sequencing
2304 reads, 2.22e+03 reads per million, 23 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI1.0) Overlapping transcripts
scaffold_11: 635724-635791 [+]
intergenic
Database links

Mature sequence nve-miR-9420

Accession MIMAT0035376
Sequence

39 - 

auacaaaucagccgacuggga

 - 59

Get sequence
Deep sequencing2302 reads, 23 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24642861 "Cnidarian microRNAs frequently regulate targets by cleavage" Moran Y, Fredman D, Praher D, Li XZ, Wee LM, Rentzsch F, Zamore PD, Technau U, Seitz H Genome Res. 24:651-663(2014).