Stem-loop sequence nve-mir-2041b-3

AccessionMI0029030 (change log)
DescriptionNematostella vectensis miR-2041b-3 stem-loop
Stem-loop
   c                               u 
5'  ucggaaacccagggguauuuuucucuaacgu u
    ||||||||||||||||||||||||||||||| c
3'  agccuuuggguccccauaaaaggagauugca a
   -                               c 
Get sequence
Deep sequencing
1946 reads, 2.4e+03 reads per million, 21 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI1.0) Overlapping transcripts
scaffold_74: 859956-860023 [-]
intergenic
Database links

Mature sequence nve-miR-2041b-5p

Accession MIMAT0035381
Sequence

11 - 

cagggguauuuuucucuaacgu

 - 32

Get sequence
Deep sequencing213 reads, 19 experiments
Evidence experimental; Illumina [1]

Mature sequence nve-miR-2041b-3p

Accession MIMAT0035382
Sequence

41 - 

uuagaggaaaauaccccugg

 - 60

Get sequence
Deep sequencing7143 reads, 21 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24642861 "Cnidarian microRNAs frequently regulate targets by cleavage" Moran Y, Fredman D, Praher D, Li XZ, Wee LM, Rentzsch F, Zamore PD, Technau U, Seitz H Genome Res. 24:651-663(2014).