Stem-loop sequence nve-mir-9454

AccessionMI0029075 (change log)
DescriptionNematostella vectensis miR-9454 stem-loop
Stem-loop
   aagacagua    -g  a ug     g      ga 
5'          ccag  uc c  uuuuu aggcau  c
            ||||  || |  ||||| ||||||   
3'          gguu  ag g  aaaag ucugug  a
   ---gauuga    gg  c ca     g      aa 
Get sequence
Deep sequencing
491 reads, 1.57e+03 reads per million, 21 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI1.0) Overlapping transcripts
scaffold_696: 10596-10663 [-]
intergenic
Database links

Mature sequence nve-miR-9454

Accession MIMAT0035415
Sequence

8 - 

uaccaggucacuguuuuugagg

 - 29

Get sequence
Deep sequencing450 reads, 21 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24642861 "Cnidarian microRNAs frequently regulate targets by cleavage" Moran Y, Fredman D, Praher D, Li XZ, Wee LM, Rentzsch F, Zamore PD, Technau U, Seitz H Genome Res. 24:651-663(2014).