Stem-loop sequence bdi-MIR5174f

AccessionMI0029180 (change log)
DescriptionBrachypodium distachyon miR5174f stem-loop
Gene family MIPF0001200; MIR5067
Literature search

1 open access papers mention bdi-MIR5174f
(4 sentences)

Stem-loop
   --             a                 g    c  c 
5'   uucccuccguuuc uaaagguuggcacgguu ugaa ua c
     ||||||||||||| ||||||||||||||||| |||| ||  
3'   gagggaggcaaag auuuccaaccgugccga acuu au u
   au             c                 a    a  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
3: 18576851-18576934 [-]
intergenic
Database links

Mature sequence bdi-miR5174f

Accession MIMAT0035538
Sequence

4 - 

ccuccguuucauaaagguugg

 - 24

Get sequence
Evidence not experimental

References

1
PMID:24367943 "Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon" Jeong DH, Schmidt SA, Rymarquis LA, Park S, Ganssmann M, German MA, Accerbi M, Zhai J, Fahlgren N, Fox SE, Garvin DF, Mockler TC, Carrington JC, Meyers BC, Green PJ Genome Biol. 14:R145(2013).