Stem-loop sequence dvi-mir-311

AccessionMI0029246 (change log)
DescriptionDrosophila virilis miR-311 stem-loop
Gene family MIPF0000566; mir-310
Stem-loop
   cgucc     -ac      a   a   uauu    a        ---    uuaa 
5'      gcaug   cauuuu agg cgg    ugug caauaugu   gcag    a
        |||||   |||||| ||| |||    |||| ||||||||   ||||     
3'      cgugc   guaaaa ucc gcc    acac guuauacg   uguu    u
   ucucu     caa      a   g   cucu    -        auu    uaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_12875: 13668884-13668990 [-]
intergenic
Clustered miRNAs
< 10kb from dvi-mir-311
dvi-mir-313scaffold_12875: 13669117-13669187 [-]
dvi-mir-311scaffold_12875: 13668884-13668990 [-]
dvi-mir-310scaffold_12875: 13668747-13668822 [-]
Database links

Mature sequence dvi-miR-311-5p

Accession MIMAT0035566
Sequence

20 - 

aggacgguauuugugacaauaug

 - 42

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dvi-miR-311-3p

Accession MIMAT0035567
Sequence

68 - 

uauugcacaucucccggccua

 - 88

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24448446 "Fast-evolving microRNAs are highly expressed in the early embryo of Drosophila virilis" Ninova M, Ronshaugen M, Griffiths-Jones S RNA. 20:360-372(2014).