Stem-loop sequence dvi-mir-999

AccessionMI0029275 (change log)
DescriptionDrosophila virilis miR-999 stem-loop
Gene family MIPF0000852; mir-999
Stem-loop
   agcgagucgcc   --         u         g      g       u uau 
5'            gcu  caauuaccg gacauaguc uacggu aauguug g   g
              |||  ||||||||| ||||||||| |||||| ||||||| |    
3'            cga  guugguggc cugugucag auguca uuguaac c   g
   ---caacuaau   uu         u         a      a       - uga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_12822: 3936743-3936848 [-]
intergenic
Database links

Mature sequence dvi-miR-999-5p

Accession MIMAT0035614
Sequence

26 - 

acauagucguacggugaauguu

 - 47

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dvi-miR-999-3p

Accession MIMAT0035615
Sequence

63 - 

uguuaacuguaagacugugucu

 - 84

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24448446 "Fast-evolving microRNAs are highly expressed in the early embryo of Drosophila virilis" Ninova M, Ronshaugen M, Griffiths-Jones S RNA. 20:360-372(2014).