Stem-loop sequence bra-MIR9408

AccessionMI0029298 (change log)
DescriptionBrassica rapa miR9408 stem-loop
Gene family MIPF0002027; MIR9408
Stem-loop
   aca     uu   -c           g    -                  g     u  ---aa c    uc 
5'    acgag  uug  uuaagacaaca ucuc aggauggaaaaugcuuuu acuua gu     c guga  a
      |||||  |||  ||||||||||| |||| |||||||||||||||||| ||||| ||     | ||||  a
3'    ugcuu  aac  aguuuuguugu agag uucuacuuuuuaugaaaa ugaau ca     g cgcu  a
   acc     -u   ca           a    a                  a     -  aaacc a    cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA1: 9651914-9652053 [-]
intergenic
Database links

Mature sequence bra-miR9408-5p

Accession MIMAT0035657
Sequence

21 - 

caacagucucaggauggaaaa

 - 41

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bra-miR9408-3p

Accession MIMAT0035658
Sequence

101 - 

uuucaucuuagagaauguuguu

 - 122

Get sequence
Evidence experimental; Illumina [1]

References

1