Stem-loop sequence bfv-miR-BF1

AccessionMI0030366 (change log)
DescriptionBovine foamy virus miR-BF1 stem-loop
Stem-loop
   --      gg      -  uca    aag 
5'   uucgga  auggcu ca   agcu   u
     ||||||  |||||| ||   ||||    
3'   gagccu  uaccga gu   ucga   a
   cg      -a      a  ccc    gga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence bfv-miR-BF1-5p

Accession MIMAT0035753
Sequence

1 - 

uucggaggauggcucaucaagc

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bfv-miR-BF1-3p

Accession MIMAT0035754
Sequence

35 - 

ucccugaagccauauccgaggc

 - 56

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24522910 "Identification of novel, highly expressed retroviral microRNAs in cells infected by bovine foamy virus" Whisnant AW, Kehl T, Bao Q, Materniak M, Kuzmak J, Lochelt M, Cullen BR J Virol. 88:4679-4686(2014).