Stem-loop sequence tae-MIR9664

AccessionMI0030385 (change log)
DescriptionTriticum aestivum miR9664 stem-loop
Literature search

1 open access papers mention tae-MIR9664
(1 sentences)

Stem-loop
   -ggucu     -uu        c       a    c         auc  a  ug   aa 
5'       gaugg   aacgaaac acggcau gagg acugcaaac   cg ga  agc  a
         |||||   |||||||| ||||||| |||| |||||||||   || ||  |||  c
3'       cuacc   uuguuuug ugcugua cucc ugacguuug   gc cu  ucg  u
   uguuau     uuu        a       g    -         -au  -  gu   aa 
Get sequence
Deep sequencing
106252 reads, 25 reads per million, 116 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
1B: 141665392-141665509 [-]
intergenic
Database links

Mature sequence tae-miR9664-3p

Accession MIMAT0035775
Sequence

77 - 

uugcaguccucgaugucguag

 - 97

Get sequence
Deep sequencing101264 reads, 116 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).