Stem-loop sequence tae-MIR5048

AccessionMI0030413 (change log)
DescriptionTriticum aestivum miR5048 stem-loop
Literature search

6 open access papers mention tae-MIR5048
(8 sentences)

Stem-loop
   u    c            ggu             ggug    u   u    ---   u   u   u      c       u   -        u    a   --        -ccca        uc  ugacuaaaaa     aaaaaguaauaauuggguguuguguucucacaaagaa 
5'  cuag aauauauuugca   uuuaggucuaagu    aaua cga cucu   gaa aua uga aaccuu acaaauu gcu gauuauuu guag gcu  auuauugu     caugcaua  ca          aagca                                     a
    |||| ||||||||||||   |||||||||||||    |||| ||| ||||   ||| ||| ||| |||||| ||||||| ||| |||||||| |||| |||  ||||||||     ||||||||  ||          |||||                                     g
3'  gauc uuauaugaacgu   agauccagauuua    uuau guu gaga   cuu uau auu uuggaa uguuuaa uga cuaguaag uauc uga  uaguaaua     guacguau  gu          uucgu                                     a
   g    u            -ac             auug    -   -    acg   c   u   u      -       -   a        u    g   aa        ccuaa        ua  ----------     aaguagaaggaaguguucaaaaacaauuugaaaaggu 
Get sequence
Deep sequencing
7445448 reads, 3.4e+04 reads per million, 116 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence tae-miR5048-5p

Accession MIMAT0035803
Sequence

13 - 

uuugcagguuuuaggucuaagu

 - 34

Get sequence
Deep sequencing7147086 reads, 116 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).