Stem-loop sequence chi-mir-2320

AccessionMI0030707 (change log)
DescriptionCapra hircus miR-2320 stem-loop
Stem-loop
   ugu     cg        u   gc        a   a 
5'    cccca  gcacaggg cca  ugucggcc uau c
      |||||  |||||||| |||  |||||||| ||| c
3'    ggggu  uguguccc ggu  guagcugg gua c
   --c     uu        u   -a        -   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr16: 49629055-49629127 [+]
intergenic
Database links

Mature sequence chi-miR-2320

Accession MIMAT0036083
Sequence

47 - 

ucgaugauggucccuguguuuu

 - 68

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).