Stem-loop sequence chi-mir-25

AccessionMI0030719 (change log)
DescriptionCapra hircus miR-25 stem-loop
Gene family MIPF0000013; mir-25
Literature search

1 open access papers mention chi-mir-25
(1 sentences)

Stem-loop
   -----c   a     c g    gag    g     uu g     u   -  acg 
5'       ggg cuggc a uguu   aggc gagac  g gcaau gcu gg   c
         ||| ||||| | ||||   |||| |||||  | ||||| ||| ||    
3'       ccc ggccg u acag   ucug cucug  c cguua cgg cc   u
   gucaca   c     - g    ---    g     uu a     -   g  ccg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr25: 38750401-38750499 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-25
chi-mir-106bchr25: 38750004-38750083 [+]
chi-mir-25chr25: 38750401-38750499 [+]
Database links

Mature sequence chi-miR-25-5p

Accession MIMAT0036099
Sequence

21 - 

aggcggagacuugggcaauugcu

 - 43

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-25-3p

Accession MIMAT0036100
Sequence

59 - 

cauugcacuugucucggucuga

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).