Stem-loop sequence chi-mir-363

AccessionMI0030762 (change log)
DescriptionCapra hircus miR-363 stem-loop
Gene family MIPF0000138; mir-363
Literature search

1 open access papers mention chi-mir-363
(27 sentences)

Stem-loop
   uuguaaaau   --cu       u   gu         ca  a         --ga   gu 
5'          gac    guuuugc guu  cggguggau  cg ugcaauuuu    uua  a
            |||    ||||||| |||  |||||||||  || |||||||||    |||   
3'          uug    caggacg caa  gucuaccua  gc acguuaaaa    gau  u
   --------g   uucc       c   gc         ug  -         agag   aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chrX: 40074650-40074760 [-]
intergenic
Clustered miRNAs
< 10kb from chi-mir-363
chi-mir-106achrX: 40075491-40075571 [-]
chi-mir-18bchrX: 40075324-40075417 [-]
chi-mir-20bchrX: 40075091-40075165 [-]
chi-mir-92bchrX: 40074814-40074900 [-]
chi-mir-363chrX: 40074650-40074760 [-]
Database links

Mature sequence chi-miR-363-5p

Accession MIMAT0036175
Sequence

28 - 

cggguggaucacgaugcaauuu

 - 49

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-363-3p

Accession MIMAT0036176
Sequence

71 - 

aauugcacgguauccaucugcg

 - 92

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).