Stem-loop sequence chi-mir-425

AccessionMI0030790 (change log)
DescriptionCapra hircus miR-425 stem-loop
Gene family MIPF0000242; mir-425
Stem-loop
   -    u  u    aau       u  c     u  ----ag   g 
5'  aaag gc uugg   gacacga ca ucccg ug      ugg c
    |||| || ||||   ||||||| || ||||| ||      |||  
3'  uuuc cg gacc   cugugcu gu agggc ac      acc a
   c    u  u    cgc       -  a     u  cgaaga   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr22: 52694380-52694465 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-425
chi-mir-191chr22: 52693899-52694002 [+]
chi-mir-425chr22: 52694380-52694465 [+]
Database links

Mature sequence chi-miR-425-5p

Accession MIMAT0036224
Sequence

13 - 

aaugacacgaucacucccguuga

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-425-3p

Accession MIMAT0036225
Sequence

53 - 

caucgggaaugucguguccgcc

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).