Stem-loop sequence chi-mir-490

AccessionMI0030805 (change log)
DescriptionCapra hircus miR-490 stem-loop
Gene family MIPF0000229; mir-490
Stem-loop
   -u    acc      g    -   aguucauu        c      --         g   cac   u 
5'   ggag   uugcug uuug gaa        guucgaca caugga  ucuccaggu ggu   guu a
     ||||   |||||| |||| |||        |||||||| ||||||  ||||||||| |||   |||  
3'   cuuc   ggcgac gaac cuu        cgaguugu guaccu  ggaggucca cca   uag g
   au    aca      -    a   ------gu        c      ca         a   -ca   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr4: 103284707-103284834 [+]
intergenic
Database links

Mature sequence chi-miR-490

Accession MIMAT0036250
Sequence

76 - 

caaccuggaggacuccaugcugu

 - 98

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).