Stem-loop sequence chi-mir-708

AccessionMI0030832 (change log)
DescriptionCapra hircus miR-708 stem-loop
Gene family MIPF0000397; mir-708
Stem-loop
   cugugu    agu   aa        a           a     c  g ------g    a 
5'       guga   ggu  cugcccuc aggagcuuaca ucuag ug g       guaa c
         ||||   |||  |||||||| ||||||||||| ||||| || |       |||| g
3'       cauu   cca  gacgggag ucuucgagugu agauc ac c       cguu a
   --aucc    ---   gg        a           c     u  g aaguaca    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr29: 16647506-16647619 [+]
intergenic
Database links

Mature sequence chi-miR-708-5p

Accession MIMAT0036290
Sequence

27 - 

aaggagcuuacaaucuagcuggg

 - 49

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-708-3p

Accession MIMAT0036291
Sequence

73 - 

caucuagacugugagcuucuaga

 - 95

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).