Stem-loop sequence chi-mir-92a

AccessionMI0030839 (change log)
DescriptionCapra hircus miR-92a stem-loop
Gene family MIPF0000013; mir-25
Literature search

1 open access papers mention chi-mir-92a
(2 sentences)

Stem-loop
   ggaaaaucaaa    ---uuu  ac            c   u           uu 
5'            cccc      cu  acagguugggau agu gcaaugcugug  u
              ||||      ||  |||||||||||| ||| |||||||||||   
3'            gggg      ga  uguccggcccug uca cguuaugguau  c
   ---------ua    ugguuu  gu            u   -           gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr12: 66730161-66730259 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-92a
chi-mir-17chr12: 66729474-66729557 [+]
chi-mir-18achr12: 66729611-66729699 [+]
chi-mir-19achr12: 66729756-66729837 [+]
chi-mir-20achr12: 66729906-66730012 [+]
chi-mir-19bchr12: 66730053-66730139 [+]
chi-mir-92achr12: 66730161-66730259 [+]
Database links

Mature sequence chi-miR-92a-5p

Accession MIMAT0036302
Sequence

25 - 

agguugggaucaguugcaaugcu

 - 47

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-92a-3p

Accession MIMAT0036303
Sequence

62 - 

uauugcacuugucccggccugu

 - 83

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).