Stem-loop sequence ocu-mir-367

AccessionMI0030991 (change log)
DescriptionOryctolagus cuniculus miR-367 stem-loop
Gene family MIPF0000162; mir-367
Stem-loop
                   ua     c    uugaa 
5' ccauuacuguugcuaa  ugcaa ucug     u
   ||||||||||||||||  ||||| ||||      
3' gguagugguaacgauu  acguu aggu     a
                   uc     a    uauau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OryCun2.0; GCA_000003625.1) Overlapping transcripts
CM000804.1: 36770233-36770300 [+]
antisense
ENSOCUT00000007074 ; LARP7-201; intron 9
Clustered miRNAs
< 10kb from ocu-mir-367
ocu-mir-302bCM000804.1: 36769627-36769706 [+]
ocu-mir-302cCM000804.1: 36769770-36769837 [+]
ocu-mir-302aCM000804.1: 36769946-36770014 [+]
ocu-mir-302dCM000804.1: 36770109-36770176 [+]
ocu-mir-367CM000804.1: 36770233-36770300 [+]
Database links

Mature sequence ocu-miR-367-5p

Accession MIMAT0036324
Sequence

6 - 

acuguugcuaauaugcaacucu

 - 27

Get sequence
Evidence experimental; SOLiD [1]

Mature sequence ocu-miR-367-3p

Accession MIMAT0036325
Sequence

44 - 

aauugcacuuuagcaaugguga

 - 65

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:23426804 "Discovery of pluripotency-associated microRNAs in rabbit preimplantation embryos and embryonic stem-like cells" Maraghechi P, Hiripi L, Toth G, Bontovics B, Bosze Z, Gocza E Reproduction. 145:421-437(2013).