Stem-loop sequence gma-MIR9735

AccessionMI0031017 (change log)
DescriptionGlycine max miR9735 stem-loop
Stem-loop
   -                                   c           g      u     c  c  c   a           gca   cccuu    au 
5'  uuugguacggcuuaaguucaacuuuggaggaaaaa auggauguuau gugcuu aagcc ug aa uuu gugcggcuuaa   cga     aagc  g
    ||||||||||||||||||||||||||||||||||| ||||||||||| |||||| ||||| || || ||| |||||||||||   |||     ||||   
3'  aaaccaugucgaauucggguugaaaccuccuuuuu uaccuacgaug cacgaa uucgg ac uu aaa uacgucgaauu   guu     uuug  c
   g                                   a           a      -     -  u  c   c           --a   -----    ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr2: 8544212-8544403 [-]
intergenic
Database links

Mature sequence gma-miR9735

Accession MIMAT0036355
Sequence

6 - 

uacggcuuaaguucaacuuuggag

 - 29

Get sequence
Evidence experimental; Illumina [1]

References

1