Stem-loop sequence gma-MIR9746d

AccessionMI0031031 (change log)
DescriptionGlycine max miR9746d stem-loop
Gene family MIPF0001884; MIR9746
Stem-loop
   ac       c  g                    aug   c          guuu 
5'   gguuauc aa ugagauucaagcacuuuucu   ugg uuuaaggugu    g
     ||||||| || ||||||||||||||||||||   ||| ||||||||||    a
3'   ccaauag uu acucuaaguuugugaaaaga   acc aaauuccaca    a
   -a       a  a                    aga   u          aggu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr3: 2853469-2853578 [+]
intergenic
Clustered miRNAs
< 10kb from gma-MIR9746d
gma-MIR9746cchr3: 2849581-2849690 [+]
gma-MIR9746dchr3: 2853469-2853578 [+]
Database links

Mature sequence gma-miR9746d

Accession MIMAT0036369
Sequence

82 - 

aaaguguuugaaucucaauuagau

 - 105

Get sequence
Evidence experimental; Illumina [1]

References

1