Stem-loop sequence gma-MIR9746e

AccessionMI0031032 (change log)
DescriptionGlycine max miR9746e stem-loop
Gene family MIPF0001884; MIR9746
Stem-loop
   ac       c                       a     c          guuu 
5'   gguuauc aauugagauucaaguacuuuuuu ugugg uuuaaggugu    g
     ||||||| ||||||||||||||||||||||| ||||| ||||||||||    a
3'   ccaauag uuaacucuaaguuugugaaaaga guacc aaauuccaua    a
   -a       a                       a     u          aggu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr3: 2883120-2883229 [+]
intergenic
Database links

Mature sequence gma-miR9746e

Accession MIMAT0036370
Sequence

82 - 

aaaguguuugaaucucaauuagau

 - 105

Get sequence
Evidence experimental; Illumina [1]

References

1