Stem-loop sequence gma-MIR9746f

AccessionMI0031033 (change log)
DescriptionGlycine max miR9746f stem-loop
Gene family MIPF0001884; MIR9746
Stem-loop
   ac       c                       a   a u          guuu 
5'   gguuauc aauugagauucaagcacuuuucu ugu g uuuaaggugu    g
     ||||||| ||||||||||||||||||||||| ||| | ||||||||||    a
3'   ccaauag uuaacucuaaguuugugaaaaga gua c aaauuccaca    a
   -a       a                       a   c u          aggu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr3: 2902023-2902132 [+]
intergenic
Clustered miRNAs
< 10kb from gma-MIR9746f
gma-MIR9746ichr3: 2894473-2894611 [+]
gma-MIR9746fchr3: 2902023-2902132 [+]
gma-MIR9746gchr3: 2905626-2906098 [+]
Database links

Mature sequence gma-miR9746f

Accession MIMAT0036371
Sequence

82 - 

aaaguguuugaaucucaauuagau

 - 105

Get sequence
Evidence experimental; Illumina [1]

References

1