Stem-loop sequence gma-MIR9746i

AccessionMI0031045 (change log)
DescriptionGlycine max miR9746i stem-loop
Gene family MIPF0001884; MIR9746
Stem-loop
           c      c       c                       a     c          guuu 
5' auaucaag uguuua gguuauc aauugagauucaagcacuuuucu ugugg uuuaaggugu    g
   |||||||| |||||| ||||||| ||||||||||||||||||||||| ||||| ||||||||||    a
3' uauaguuc acagau ccaauag uuaacuuuaaguuugugaaaaga guacc aaauuccaca    a
           a      a       a                       a     u          aggu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr3: 2894473-2894611 [+]
intergenic
Clustered miRNAs
< 10kb from gma-MIR9746i
gma-MIR9746ichr3: 2894473-2894611 [+]
gma-MIR9746fchr3: 2902023-2902132 [+]
Database links

Mature sequence gma-miR9746i

Accession MIMAT0036383
Sequence

96 - 

aaaguguuugaauuucaauuagau

 - 119

Get sequence
Evidence experimental; Illumina [1]

References

1