Stem-loop sequence gma-MIR4348c

AccessionMI0031051 (change log)
DescriptionGlycine max miR4348c stem-loop
Literature search

1 open access papers mention gma-MIR4348c
(1 sentences)

Stem-loop
   -a                       cau         a    ----uagaa    uuagaaua 
5'   uauguguuaaacuugcaagauga   uauuaugau guug         acau        g
     |||||||||||||||||||||||   ||||||||| ||||         ||||        c
3'   auacacaauuugaauguucuacu   auaaugcua caac         ugua        a
   ua                       auu         -    uuaugagag    ugaccaga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr2: 10880344-10880466 [+]
intergenic
Database links

Mature sequence gma-miR4348c

Accession MIMAT0036389
Sequence

6 - 

uguuaaacuugcaagaugaca

 - 26

Get sequence
Evidence experimental; Illumina [1]

References

1